ID: 1156781117 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 18:40852090-40852112 |
Sequence | TGGGACTAATTTCACAGAGA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1156781111_1156781117 | 23 | Left | 1156781111 | 18:40852044-40852066 | CCTCAGTGGGTCATCTAAACACT | No data | ||
Right | 1156781117 | 18:40852090-40852112 | TGGGACTAATTTCACAGAGATGG | No data | ||||
1156781110_1156781117 | 29 | Left | 1156781110 | 18:40852038-40852060 | CCAGCTCCTCAGTGGGTCATCTA | No data | ||
Right | 1156781117 | 18:40852090-40852112 | TGGGACTAATTTCACAGAGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1156781117 | Original CRISPR | TGGGACTAATTTCACAGAGA TGG | Intergenic | ||