ID: 1156781118

View in Genome Browser
Species Human (GRCh38)
Location 18:40852091-40852113
Sequence GGGACTAATTTCACAGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156781111_1156781118 24 Left 1156781111 18:40852044-40852066 CCTCAGTGGGTCATCTAAACACT No data
Right 1156781118 18:40852091-40852113 GGGACTAATTTCACAGAGATGGG No data
1156781110_1156781118 30 Left 1156781110 18:40852038-40852060 CCAGCTCCTCAGTGGGTCATCTA No data
Right 1156781118 18:40852091-40852113 GGGACTAATTTCACAGAGATGGG No data
1156781116_1156781118 -10 Left 1156781116 18:40852078-40852100 CCATGGTCTCACTGGGACTAATT No data
Right 1156781118 18:40852091-40852113 GGGACTAATTTCACAGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156781118 Original CRISPR GGGACTAATTTCACAGAGAT GGG Intergenic
No off target data available for this crispr