ID: 1156782730

View in Genome Browser
Species Human (GRCh38)
Location 18:40870618-40870640
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156782730_1156782740 13 Left 1156782730 18:40870618-40870640 CCCATTGGAGTGAGCCATTTCCA No data
Right 1156782740 18:40870654-40870676 CACTTGAATATTCCACTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156782730 Original CRISPR TGGAAATGGCTCACTCCAAT GGG (reversed) Intergenic
No off target data available for this crispr