ID: 1156785229

View in Genome Browser
Species Human (GRCh38)
Location 18:40904494-40904516
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156785229_1156785232 20 Left 1156785229 18:40904494-40904516 CCAGCATGCTGAGTTTTAGCAGC No data
Right 1156785232 18:40904537-40904559 AAAGTCTCCAGAACCTATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156785229 Original CRISPR GCTGCTAAAACTCAGCATGC TGG (reversed) Intergenic
No off target data available for this crispr