ID: 1156787600

View in Genome Browser
Species Human (GRCh38)
Location 18:40934320-40934342
Sequence AATGAAAAGCAGACATTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156787600_1156787602 -6 Left 1156787600 18:40934320-40934342 CCATCCAATGTCTGCTTTTCATT No data
Right 1156787602 18:40934337-40934359 TTCATTTTAACTGCCTAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156787600 Original CRISPR AATGAAAAGCAGACATTGGA TGG (reversed) Intergenic
No off target data available for this crispr