ID: 1156791659

View in Genome Browser
Species Human (GRCh38)
Location 18:40983113-40983135
Sequence CATGCTACTGACTCTTTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156791659_1156791660 16 Left 1156791659 18:40983113-40983135 CCAACAAAAGAGTCAGTAGCATG No data
Right 1156791660 18:40983152-40983174 CTGTTGAGTTCTAGACCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156791659 Original CRISPR CATGCTACTGACTCTTTTGT TGG (reversed) Intergenic
No off target data available for this crispr