ID: 1156799571

View in Genome Browser
Species Human (GRCh38)
Location 18:41093122-41093144
Sequence TCCATGTCTTCAACTCACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156799566_1156799571 30 Left 1156799566 18:41093069-41093091 CCGCCATTCTCACTATCCCCATT No data
Right 1156799571 18:41093122-41093144 TCCATGTCTTCAACTCACAAAGG No data
1156799570_1156799571 12 Left 1156799570 18:41093087-41093109 CCATTTTAATGCATTATTTACAT No data
Right 1156799571 18:41093122-41093144 TCCATGTCTTCAACTCACAAAGG No data
1156799569_1156799571 13 Left 1156799569 18:41093086-41093108 CCCATTTTAATGCATTATTTACA No data
Right 1156799571 18:41093122-41093144 TCCATGTCTTCAACTCACAAAGG No data
1156799567_1156799571 27 Left 1156799567 18:41093072-41093094 CCATTCTCACTATCCCCATTTTA No data
Right 1156799571 18:41093122-41093144 TCCATGTCTTCAACTCACAAAGG No data
1156799568_1156799571 14 Left 1156799568 18:41093085-41093107 CCCCATTTTAATGCATTATTTAC No data
Right 1156799571 18:41093122-41093144 TCCATGTCTTCAACTCACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156799571 Original CRISPR TCCATGTCTTCAACTCACAA AGG Intergenic
No off target data available for this crispr