ID: 1156801072

View in Genome Browser
Species Human (GRCh38)
Location 18:41114654-41114676
Sequence ATCTAATGCCAAAAGTATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156801072_1156801074 -7 Left 1156801072 18:41114654-41114676 CCATAATACTTTTGGCATTAGAT No data
Right 1156801074 18:41114670-41114692 ATTAGATTCTGAGGAGACTGAGG No data
1156801072_1156801075 -2 Left 1156801072 18:41114654-41114676 CCATAATACTTTTGGCATTAGAT No data
Right 1156801075 18:41114675-41114697 ATTCTGAGGAGACTGAGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156801072 Original CRISPR ATCTAATGCCAAAAGTATTA TGG (reversed) Intergenic
No off target data available for this crispr