ID: 1156801883

View in Genome Browser
Species Human (GRCh38)
Location 18:41125195-41125217
Sequence TAGGCTTATCCCTTCATGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156801883_1156801886 7 Left 1156801883 18:41125195-41125217 CCAACCATGAAGGGATAAGCCTA No data
Right 1156801886 18:41125225-41125247 ATCAGATCATCTTCTAAAAGAGG No data
1156801883_1156801887 8 Left 1156801883 18:41125195-41125217 CCAACCATGAAGGGATAAGCCTA No data
Right 1156801887 18:41125226-41125248 TCAGATCATCTTCTAAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156801883 Original CRISPR TAGGCTTATCCCTTCATGGT TGG (reversed) Intergenic
No off target data available for this crispr