ID: 1156803791

View in Genome Browser
Species Human (GRCh38)
Location 18:41151476-41151498
Sequence ACATATAAGGTACAATTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156803791_1156803795 -6 Left 1156803791 18:41151476-41151498 CCCTCAAATTGTACCTTATATGT No data
Right 1156803795 18:41151493-41151515 ATATGTACCTAAGTCTTTCTGGG No data
1156803791_1156803794 -7 Left 1156803791 18:41151476-41151498 CCCTCAAATTGTACCTTATATGT No data
Right 1156803794 18:41151492-41151514 TATATGTACCTAAGTCTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156803791 Original CRISPR ACATATAAGGTACAATTTGA GGG (reversed) Intergenic
No off target data available for this crispr