ID: 1156806716

View in Genome Browser
Species Human (GRCh38)
Location 18:41191787-41191809
Sequence CAGTGTGAACACAGGCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156806716_1156806718 4 Left 1156806716 18:41191787-41191809 CCATCTTGCCTGTGTTCACACTG No data
Right 1156806718 18:41191814-41191836 AACCACACAAAATTTCCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156806716 Original CRISPR CAGTGTGAACACAGGCAAGA TGG (reversed) Intergenic
No off target data available for this crispr