ID: 1156806718

View in Genome Browser
Species Human (GRCh38)
Location 18:41191814-41191836
Sequence AACCACACAAAATTTCCTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156806716_1156806718 4 Left 1156806716 18:41191787-41191809 CCATCTTGCCTGTGTTCACACTG No data
Right 1156806718 18:41191814-41191836 AACCACACAAAATTTCCTTTAGG No data
1156806715_1156806718 5 Left 1156806715 18:41191786-41191808 CCCATCTTGCCTGTGTTCACACT No data
Right 1156806718 18:41191814-41191836 AACCACACAAAATTTCCTTTAGG No data
1156806717_1156806718 -4 Left 1156806717 18:41191795-41191817 CCTGTGTTCACACTGCTGCAACC No data
Right 1156806718 18:41191814-41191836 AACCACACAAAATTTCCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156806718 Original CRISPR AACCACACAAAATTTCCTTT AGG Intergenic
No off target data available for this crispr