ID: 1156808674

View in Genome Browser
Species Human (GRCh38)
Location 18:41220888-41220910
Sequence ATGGCAGAATGGAATGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156808668_1156808674 21 Left 1156808668 18:41220844-41220866 CCTAATCTTTTAATTATTTTATT No data
Right 1156808674 18:41220888-41220910 ATGGCAGAATGGAATGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156808674 Original CRISPR ATGGCAGAATGGAATGAGGT GGG Intergenic
No off target data available for this crispr