ID: 1156812946

View in Genome Browser
Species Human (GRCh38)
Location 18:41274238-41274260
Sequence CAGGGGAAAGAGTAGCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156812940_1156812946 -8 Left 1156812940 18:41274223-41274245 CCCACCAACAATTACCAGGGGAA No data
Right 1156812946 18:41274238-41274260 CAGGGGAAAGAGTAGCAGGAGGG No data
1156812941_1156812946 -9 Left 1156812941 18:41274224-41274246 CCACCAACAATTACCAGGGGAAA No data
Right 1156812946 18:41274238-41274260 CAGGGGAAAGAGTAGCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156812946 Original CRISPR CAGGGGAAAGAGTAGCAGGA GGG Intergenic
No off target data available for this crispr