ID: 1156814250

View in Genome Browser
Species Human (GRCh38)
Location 18:41290310-41290332
Sequence TTTTTTCTAGTGGTTGCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156814250_1156814252 15 Left 1156814250 18:41290310-41290332 CCAAAAGCAACCACTAGAAAAAA No data
Right 1156814252 18:41290348-41290370 ATGTAAAAATCAACAGAAGATGG No data
1156814250_1156814256 28 Left 1156814250 18:41290310-41290332 CCAAAAGCAACCACTAGAAAAAA No data
Right 1156814256 18:41290361-41290383 CAGAAGATGGCCGGGCACGGTGG No data
1156814250_1156814255 25 Left 1156814250 18:41290310-41290332 CCAAAAGCAACCACTAGAAAAAA No data
Right 1156814255 18:41290358-41290380 CAACAGAAGATGGCCGGGCACGG No data
1156814250_1156814253 19 Left 1156814250 18:41290310-41290332 CCAAAAGCAACCACTAGAAAAAA No data
Right 1156814253 18:41290352-41290374 AAAAATCAACAGAAGATGGCCGG No data
1156814250_1156814254 20 Left 1156814250 18:41290310-41290332 CCAAAAGCAACCACTAGAAAAAA No data
Right 1156814254 18:41290353-41290375 AAAATCAACAGAAGATGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156814250 Original CRISPR TTTTTTCTAGTGGTTGCTTT TGG (reversed) Intergenic
No off target data available for this crispr