ID: 1156814251

View in Genome Browser
Species Human (GRCh38)
Location 18:41290320-41290342
Sequence TTTTGAGTTATTTTTTCTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156814251_1156814254 10 Left 1156814251 18:41290320-41290342 CCACTAGAAAAAATAACTCAAAA No data
Right 1156814254 18:41290353-41290375 AAAATCAACAGAAGATGGCCGGG No data
1156814251_1156814256 18 Left 1156814251 18:41290320-41290342 CCACTAGAAAAAATAACTCAAAA No data
Right 1156814256 18:41290361-41290383 CAGAAGATGGCCGGGCACGGTGG No data
1156814251_1156814252 5 Left 1156814251 18:41290320-41290342 CCACTAGAAAAAATAACTCAAAA No data
Right 1156814252 18:41290348-41290370 ATGTAAAAATCAACAGAAGATGG No data
1156814251_1156814253 9 Left 1156814251 18:41290320-41290342 CCACTAGAAAAAATAACTCAAAA No data
Right 1156814253 18:41290352-41290374 AAAAATCAACAGAAGATGGCCGG No data
1156814251_1156814255 15 Left 1156814251 18:41290320-41290342 CCACTAGAAAAAATAACTCAAAA No data
Right 1156814255 18:41290358-41290380 CAACAGAAGATGGCCGGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156814251 Original CRISPR TTTTGAGTTATTTTTTCTAG TGG (reversed) Intergenic
No off target data available for this crispr