ID: 1156814253

View in Genome Browser
Species Human (GRCh38)
Location 18:41290352-41290374
Sequence AAAAATCAACAGAAGATGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156814251_1156814253 9 Left 1156814251 18:41290320-41290342 CCACTAGAAAAAATAACTCAAAA No data
Right 1156814253 18:41290352-41290374 AAAAATCAACAGAAGATGGCCGG No data
1156814250_1156814253 19 Left 1156814250 18:41290310-41290332 CCAAAAGCAACCACTAGAAAAAA No data
Right 1156814253 18:41290352-41290374 AAAAATCAACAGAAGATGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156814253 Original CRISPR AAAAATCAACAGAAGATGGC CGG Intergenic
No off target data available for this crispr