ID: 1156816279

View in Genome Browser
Species Human (GRCh38)
Location 18:41315449-41315471
Sequence GTTTTTAAGAATATTTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156816279_1156816286 5 Left 1156816279 18:41315449-41315471 CCTTCCAAAATATTCTTAAAAAC No data
Right 1156816286 18:41315477-41315499 CCCCCGAGCTCTCAGAGAGGTGG No data
1156816279_1156816284 2 Left 1156816279 18:41315449-41315471 CCTTCCAAAATATTCTTAAAAAC No data
Right 1156816284 18:41315474-41315496 TGGCCCCCGAGCTCTCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156816279 Original CRISPR GTTTTTAAGAATATTTTGGA AGG (reversed) Intergenic
No off target data available for this crispr