ID: 1156816522

View in Genome Browser
Species Human (GRCh38)
Location 18:41317801-41317823
Sequence CTGTCTAAATGCCAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156816522_1156816526 2 Left 1156816522 18:41317801-41317823 CCTTCCACCTGGCATTTAGACAG No data
Right 1156816526 18:41317826-41317848 CTTTCTTTTGCTGGAACTTGTGG No data
1156816522_1156816525 -7 Left 1156816522 18:41317801-41317823 CCTTCCACCTGGCATTTAGACAG No data
Right 1156816525 18:41317817-41317839 TAGACAGTGCTTTCTTTTGCTGG No data
1156816522_1156816527 3 Left 1156816522 18:41317801-41317823 CCTTCCACCTGGCATTTAGACAG No data
Right 1156816527 18:41317827-41317849 TTTCTTTTGCTGGAACTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156816522 Original CRISPR CTGTCTAAATGCCAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr