ID: 1156816848

View in Genome Browser
Species Human (GRCh38)
Location 18:41321663-41321685
Sequence CACTGCCCCAATCATCTTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156816848_1156816851 2 Left 1156816848 18:41321663-41321685 CCCAAAAGATGATTGGGGCAGTG No data
Right 1156816851 18:41321688-41321710 CAGGCAAACCCAAGAAAGTCAGG No data
1156816848_1156816854 11 Left 1156816848 18:41321663-41321685 CCCAAAAGATGATTGGGGCAGTG No data
Right 1156816854 18:41321697-41321719 CCAAGAAAGTCAGGTCTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156816848 Original CRISPR CACTGCCCCAATCATCTTTT GGG (reversed) Intergenic
No off target data available for this crispr