ID: 1156828368

View in Genome Browser
Species Human (GRCh38)
Location 18:41461401-41461423
Sequence ACACATGGAAAGCAGCAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156828363_1156828368 8 Left 1156828363 18:41461370-41461392 CCATTAATCAAAGCACTTTATAT No data
Right 1156828368 18:41461401-41461423 ACACATGGAAAGCAGCAGGTGGG No data
1156828362_1156828368 13 Left 1156828362 18:41461365-41461387 CCTGTCCATTAATCAAAGCACTT No data
Right 1156828368 18:41461401-41461423 ACACATGGAAAGCAGCAGGTGGG No data
1156828361_1156828368 18 Left 1156828361 18:41461360-41461382 CCTGTCCTGTCCATTAATCAAAG No data
Right 1156828368 18:41461401-41461423 ACACATGGAAAGCAGCAGGTGGG No data
1156828360_1156828368 19 Left 1156828360 18:41461359-41461381 CCCTGTCCTGTCCATTAATCAAA No data
Right 1156828368 18:41461401-41461423 ACACATGGAAAGCAGCAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156828368 Original CRISPR ACACATGGAAAGCAGCAGGT GGG Intergenic
No off target data available for this crispr