ID: 1156831466

View in Genome Browser
Species Human (GRCh38)
Location 18:41497204-41497226
Sequence TCATATCTGCAAAAATTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156831465_1156831466 6 Left 1156831465 18:41497175-41497197 CCTTTCTAAATCACTGACACAGT No data
Right 1156831466 18:41497204-41497226 TCATATCTGCAAAAATTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156831466 Original CRISPR TCATATCTGCAAAAATTGTA AGG Intergenic
No off target data available for this crispr