ID: 1156838971

View in Genome Browser
Species Human (GRCh38)
Location 18:41588922-41588944
Sequence CCGAGCTATAACTCAAAAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156838966_1156838971 3 Left 1156838966 18:41588896-41588918 CCATGAAATAGGAAAGGGCAAGC No data
Right 1156838971 18:41588922-41588944 CCGAGCTATAACTCAAAAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156838971 Original CRISPR CCGAGCTATAACTCAAAAGG CGG Intergenic
No off target data available for this crispr