ID: 1156842399

View in Genome Browser
Species Human (GRCh38)
Location 18:41624833-41624855
Sequence GGTCTCAGTGTACCCTTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156842399_1156842402 13 Left 1156842399 18:41624833-41624855 CCTTCTAAGGGTACACTGAGACC No data
Right 1156842402 18:41624869-41624891 AAGTCCAGTTCTTTTTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156842399 Original CRISPR GGTCTCAGTGTACCCTTAGA AGG (reversed) Intergenic
No off target data available for this crispr