ID: 1156842402

View in Genome Browser
Species Human (GRCh38)
Location 18:41624869-41624891
Sequence AAGTCCAGTTCTTTTTTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156842399_1156842402 13 Left 1156842399 18:41624833-41624855 CCTTCTAAGGGTACACTGAGACC No data
Right 1156842402 18:41624869-41624891 AAGTCCAGTTCTTTTTTTGTTGG No data
1156842394_1156842402 28 Left 1156842394 18:41624818-41624840 CCCCAAATTAATGCGCCTTCTAA No data
Right 1156842402 18:41624869-41624891 AAGTCCAGTTCTTTTTTTGTTGG No data
1156842400_1156842402 -8 Left 1156842400 18:41624854-41624876 CCAGCCATTTATTTCAAGTCCAG No data
Right 1156842402 18:41624869-41624891 AAGTCCAGTTCTTTTTTTGTTGG No data
1156842395_1156842402 27 Left 1156842395 18:41624819-41624841 CCCAAATTAATGCGCCTTCTAAG No data
Right 1156842402 18:41624869-41624891 AAGTCCAGTTCTTTTTTTGTTGG No data
1156842396_1156842402 26 Left 1156842396 18:41624820-41624842 CCAAATTAATGCGCCTTCTAAGG No data
Right 1156842402 18:41624869-41624891 AAGTCCAGTTCTTTTTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156842402 Original CRISPR AAGTCCAGTTCTTTTTTTGT TGG Intergenic
No off target data available for this crispr