ID: 1156844213

View in Genome Browser
Species Human (GRCh38)
Location 18:41645259-41645281
Sequence TCTTCTAATGCCCCACACGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156844213_1156844217 -1 Left 1156844213 18:41645259-41645281 CCACCGTGTGGGGCATTAGAAGA No data
Right 1156844217 18:41645281-41645303 ACCATGAGGTAGTGTGTGAAGGG No data
1156844213_1156844216 -2 Left 1156844213 18:41645259-41645281 CCACCGTGTGGGGCATTAGAAGA No data
Right 1156844216 18:41645280-41645302 GACCATGAGGTAGTGTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156844213 Original CRISPR TCTTCTAATGCCCCACACGG TGG (reversed) Intergenic
No off target data available for this crispr