ID: 1156844770

View in Genome Browser
Species Human (GRCh38)
Location 18:41652657-41652679
Sequence CAGTGAAAGAAGAATGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156844765_1156844770 12 Left 1156844765 18:41652622-41652644 CCTTCAGATTGTGATGCGCCTGT No data
Right 1156844770 18:41652657-41652679 CAGTGAAAGAAGAATGGGGCAGG No data
1156844766_1156844770 -6 Left 1156844766 18:41652640-41652662 CCTGTGAAAGAAAAGAGCAGTGA No data
Right 1156844770 18:41652657-41652679 CAGTGAAAGAAGAATGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156844770 Original CRISPR CAGTGAAAGAAGAATGGGGC AGG Intergenic
No off target data available for this crispr