ID: 1156845977

View in Genome Browser
Species Human (GRCh38)
Location 18:41665608-41665630
Sequence AATCTGGGTCTCTCAGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156845977_1156845982 20 Left 1156845977 18:41665608-41665630 CCTGGCTCTGAGAGACCCAGATT No data
Right 1156845982 18:41665651-41665673 CATCAGCCAAAGCAATAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156845977 Original CRISPR AATCTGGGTCTCTCAGAGCC AGG (reversed) Intergenic