ID: 1156848209

View in Genome Browser
Species Human (GRCh38)
Location 18:41694397-41694419
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156848208_1156848209 1 Left 1156848208 18:41694373-41694395 CCTCTACTTATAAAAAAAAAGTC No data
Right 1156848209 18:41694397-41694419 GTATAGACATACAATTATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156848209 Original CRISPR GTATAGACATACAATTATAA AGG Intergenic
No off target data available for this crispr