ID: 1156852829

View in Genome Browser
Species Human (GRCh38)
Location 18:41747885-41747907
Sequence TTTTTAAAGTACATTAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156852829_1156852833 18 Left 1156852829 18:41747885-41747907 CCATCCTTAATGTACTTTAAAAA No data
Right 1156852833 18:41747926-41747948 GCTTTAACTTGCACAGTGTCTGG No data
1156852829_1156852835 29 Left 1156852829 18:41747885-41747907 CCATCCTTAATGTACTTTAAAAA No data
Right 1156852835 18:41747937-41747959 CACAGTGTCTGGAAGGAAAAAGG No data
1156852829_1156852834 22 Left 1156852829 18:41747885-41747907 CCATCCTTAATGTACTTTAAAAA No data
Right 1156852834 18:41747930-41747952 TAACTTGCACAGTGTCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156852829 Original CRISPR TTTTTAAAGTACATTAAGGA TGG (reversed) Intergenic
No off target data available for this crispr