ID: 1156857306

View in Genome Browser
Species Human (GRCh38)
Location 18:41797236-41797258
Sequence CAACTGGAAGAGATAGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156857303_1156857306 11 Left 1156857303 18:41797202-41797224 CCTAGGAATTTATGAAGAAGCTT No data
Right 1156857306 18:41797236-41797258 CAACTGGAAGAGATAGCCCCAGG No data
1156857301_1156857306 17 Left 1156857301 18:41797196-41797218 CCTTGCCCTAGGAATTTATGAAG No data
Right 1156857306 18:41797236-41797258 CAACTGGAAGAGATAGCCCCAGG No data
1156857302_1156857306 12 Left 1156857302 18:41797201-41797223 CCCTAGGAATTTATGAAGAAGCT No data
Right 1156857306 18:41797236-41797258 CAACTGGAAGAGATAGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156857306 Original CRISPR CAACTGGAAGAGATAGCCCC AGG Intergenic
No off target data available for this crispr