ID: 1156858120

View in Genome Browser
Species Human (GRCh38)
Location 18:41806470-41806492
Sequence TCCTCACCAGCCGGGCAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156858113_1156858120 -8 Left 1156858113 18:41806455-41806477 CCGCCATATCTCCCCTCCTCACC No data
Right 1156858120 18:41806470-41806492 TCCTCACCAGCCGGGCAAGATGG No data
1156858112_1156858120 -7 Left 1156858112 18:41806454-41806476 CCCGCCATATCTCCCCTCCTCAC No data
Right 1156858120 18:41806470-41806492 TCCTCACCAGCCGGGCAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156858120 Original CRISPR TCCTCACCAGCCGGGCAAGA TGG Intergenic