ID: 1156859401

View in Genome Browser
Species Human (GRCh38)
Location 18:41818526-41818548
Sequence ACAGCTAGAGAGTTTAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156859401_1156859402 -5 Left 1156859401 18:41818526-41818548 CCTGCTTTAAACTCTCTAGCTGT No data
Right 1156859402 18:41818544-41818566 GCTGTGTCCCCAGCCCTCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156859401 Original CRISPR ACAGCTAGAGAGTTTAAAGC AGG (reversed) Intergenic
No off target data available for this crispr