ID: 1156859952

View in Genome Browser
Species Human (GRCh38)
Location 18:41824315-41824337
Sequence AGGGATAACAAGAGGAAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156859950_1156859952 -7 Left 1156859950 18:41824299-41824321 CCAAGCTGCAGAGCAAAGGGATA No data
Right 1156859952 18:41824315-41824337 AGGGATAACAAGAGGAAGCTAGG No data
1156859947_1156859952 8 Left 1156859947 18:41824284-41824306 CCATTTCGTGCATCACCAAGCTG No data
Right 1156859952 18:41824315-41824337 AGGGATAACAAGAGGAAGCTAGG No data
1156859946_1156859952 13 Left 1156859946 18:41824279-41824301 CCTCTCCATTTCGTGCATCACCA No data
Right 1156859952 18:41824315-41824337 AGGGATAACAAGAGGAAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156859952 Original CRISPR AGGGATAACAAGAGGAAGCT AGG Intergenic
No off target data available for this crispr