ID: 1156863432

View in Genome Browser
Species Human (GRCh38)
Location 18:41864283-41864305
Sequence CACATCTTACTGGGCCAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156863432_1156863436 30 Left 1156863432 18:41864283-41864305 CCTCCTTGGCCCAGTAAGATGTG No data
Right 1156863436 18:41864336-41864358 ATTTTTATCAGAGCTGCGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156863432 Original CRISPR CACATCTTACTGGGCCAAGG AGG (reversed) Intergenic