ID: 1156863433

View in Genome Browser
Species Human (GRCh38)
Location 18:41864286-41864308
Sequence AATCACATCTTACTGGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156863433_1156863436 27 Left 1156863433 18:41864286-41864308 CCTTGGCCCAGTAAGATGTGATT No data
Right 1156863436 18:41864336-41864358 ATTTTTATCAGAGCTGCGTAAGG No data
1156863433_1156863437 30 Left 1156863433 18:41864286-41864308 CCTTGGCCCAGTAAGATGTGATT No data
Right 1156863437 18:41864339-41864361 TTTATCAGAGCTGCGTAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156863433 Original CRISPR AATCACATCTTACTGGGCCA AGG (reversed) Intergenic