ID: 1156863434 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:41864292-41864314 |
| Sequence | TCAAGAAATCACATCTTACT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1156863434_1156863436 | 21 | Left | 1156863434 | 18:41864292-41864314 | CCCAGTAAGATGTGATTTCTTGA | No data | ||
| Right | 1156863436 | 18:41864336-41864358 | ATTTTTATCAGAGCTGCGTAAGG | 0: 1 1: 0 2: 1 3: 1 4: 92 |
||||
| 1156863434_1156863437 | 24 | Left | 1156863434 | 18:41864292-41864314 | CCCAGTAAGATGTGATTTCTTGA | No data | ||
| Right | 1156863437 | 18:41864339-41864361 | TTTATCAGAGCTGCGTAAGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1156863434 | Original CRISPR | TCAAGAAATCACATCTTACT GGG (reversed) | Intergenic | ||