ID: 1156863436

View in Genome Browser
Species Human (GRCh38)
Location 18:41864336-41864358
Sequence ATTTTTATCAGAGCTGCGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156863434_1156863436 21 Left 1156863434 18:41864292-41864314 CCCAGTAAGATGTGATTTCTTGA No data
Right 1156863436 18:41864336-41864358 ATTTTTATCAGAGCTGCGTAAGG No data
1156863432_1156863436 30 Left 1156863432 18:41864283-41864305 CCTCCTTGGCCCAGTAAGATGTG No data
Right 1156863436 18:41864336-41864358 ATTTTTATCAGAGCTGCGTAAGG No data
1156863435_1156863436 20 Left 1156863435 18:41864293-41864315 CCAGTAAGATGTGATTTCTTGAC No data
Right 1156863436 18:41864336-41864358 ATTTTTATCAGAGCTGCGTAAGG No data
1156863433_1156863436 27 Left 1156863433 18:41864286-41864308 CCTTGGCCCAGTAAGATGTGATT No data
Right 1156863436 18:41864336-41864358 ATTTTTATCAGAGCTGCGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156863436 Original CRISPR ATTTTTATCAGAGCTGCGTA AGG Intergenic