ID: 1156863437

View in Genome Browser
Species Human (GRCh38)
Location 18:41864339-41864361
Sequence TTTATCAGAGCTGCGTAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156863433_1156863437 30 Left 1156863433 18:41864286-41864308 CCTTGGCCCAGTAAGATGTGATT No data
Right 1156863437 18:41864339-41864361 TTTATCAGAGCTGCGTAAGGTGG No data
1156863435_1156863437 23 Left 1156863435 18:41864293-41864315 CCAGTAAGATGTGATTTCTTGAC No data
Right 1156863437 18:41864339-41864361 TTTATCAGAGCTGCGTAAGGTGG No data
1156863434_1156863437 24 Left 1156863434 18:41864292-41864314 CCCAGTAAGATGTGATTTCTTGA No data
Right 1156863437 18:41864339-41864361 TTTATCAGAGCTGCGTAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156863437 Original CRISPR TTTATCAGAGCTGCGTAAGG TGG Intergenic
No off target data available for this crispr