ID: 1156864060

View in Genome Browser
Species Human (GRCh38)
Location 18:41869086-41869108
Sequence TTCCAGGGGATTCAGGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156864060_1156864066 -5 Left 1156864060 18:41869086-41869108 CCTTCTCCCTGAATCCCCTGGAA No data
Right 1156864066 18:41869104-41869126 TGGAAGAACTGACAACTGCCTGG No data
1156864060_1156864069 25 Left 1156864060 18:41869086-41869108 CCTTCTCCCTGAATCCCCTGGAA No data
Right 1156864069 18:41869134-41869156 AAAATGAAATTGACATTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156864060 Original CRISPR TTCCAGGGGATTCAGGGAGA AGG (reversed) Intergenic
No off target data available for this crispr