ID: 1156864064

View in Genome Browser
Species Human (GRCh38)
Location 18:41869101-41869123
Sequence GGCAGTTGTCAGTTCTTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156864064_1156864070 16 Left 1156864064 18:41869101-41869123 CCCTGGAAGAACTGACAACTGCC No data
Right 1156864070 18:41869140-41869162 AAATTGACATTTACAGGCTTAGG No data
1156864064_1156864069 10 Left 1156864064 18:41869101-41869123 CCCTGGAAGAACTGACAACTGCC No data
Right 1156864069 18:41869134-41869156 AAAATGAAATTGACATTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156864064 Original CRISPR GGCAGTTGTCAGTTCTTCCA GGG (reversed) Intergenic
No off target data available for this crispr