ID: 1156864065

View in Genome Browser
Species Human (GRCh38)
Location 18:41869102-41869124
Sequence AGGCAGTTGTCAGTTCTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156864065_1156864070 15 Left 1156864065 18:41869102-41869124 CCTGGAAGAACTGACAACTGCCT No data
Right 1156864070 18:41869140-41869162 AAATTGACATTTACAGGCTTAGG No data
1156864065_1156864069 9 Left 1156864065 18:41869102-41869124 CCTGGAAGAACTGACAACTGCCT No data
Right 1156864069 18:41869134-41869156 AAAATGAAATTGACATTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156864065 Original CRISPR AGGCAGTTGTCAGTTCTTCC AGG (reversed) Intergenic
No off target data available for this crispr