ID: 1156864068

View in Genome Browser
Species Human (GRCh38)
Location 18:41869127-41869149
Sequence ATGTCAATTTCATTTTGTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156864068_1156864070 -10 Left 1156864068 18:41869127-41869149 CCTTTACAAAATGAAATTGACAT No data
Right 1156864070 18:41869140-41869162 AAATTGACATTTACAGGCTTAGG No data
1156864068_1156864075 19 Left 1156864068 18:41869127-41869149 CCTTTACAAAATGAAATTGACAT No data
Right 1156864075 18:41869169-41869191 AGAAACTGAAAGGGAGGTCTGGG No data
1156864068_1156864073 13 Left 1156864068 18:41869127-41869149 CCTTTACAAAATGAAATTGACAT No data
Right 1156864073 18:41869163-41869185 TTCAACAGAAACTGAAAGGGAGG No data
1156864068_1156864071 9 Left 1156864068 18:41869127-41869149 CCTTTACAAAATGAAATTGACAT No data
Right 1156864071 18:41869159-41869181 TAGGTTCAACAGAAACTGAAAGG No data
1156864068_1156864076 22 Left 1156864068 18:41869127-41869149 CCTTTACAAAATGAAATTGACAT No data
Right 1156864076 18:41869172-41869194 AACTGAAAGGGAGGTCTGGGAGG No data
1156864068_1156864074 18 Left 1156864068 18:41869127-41869149 CCTTTACAAAATGAAATTGACAT No data
Right 1156864074 18:41869168-41869190 CAGAAACTGAAAGGGAGGTCTGG No data
1156864068_1156864072 10 Left 1156864068 18:41869127-41869149 CCTTTACAAAATGAAATTGACAT No data
Right 1156864072 18:41869160-41869182 AGGTTCAACAGAAACTGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156864068 Original CRISPR ATGTCAATTTCATTTTGTAA AGG (reversed) Intergenic
No off target data available for this crispr