ID: 1156864070

View in Genome Browser
Species Human (GRCh38)
Location 18:41869140-41869162
Sequence AAATTGACATTTACAGGCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156864063_1156864070 17 Left 1156864063 18:41869100-41869122 CCCCTGGAAGAACTGACAACTGC No data
Right 1156864070 18:41869140-41869162 AAATTGACATTTACAGGCTTAGG No data
1156864062_1156864070 24 Left 1156864062 18:41869093-41869115 CCTGAATCCCCTGGAAGAACTGA No data
Right 1156864070 18:41869140-41869162 AAATTGACATTTACAGGCTTAGG No data
1156864061_1156864070 25 Left 1156864061 18:41869092-41869114 CCCTGAATCCCCTGGAAGAACTG No data
Right 1156864070 18:41869140-41869162 AAATTGACATTTACAGGCTTAGG No data
1156864067_1156864070 -5 Left 1156864067 18:41869122-41869144 CCTGGCCTTTACAAAATGAAATT No data
Right 1156864070 18:41869140-41869162 AAATTGACATTTACAGGCTTAGG No data
1156864065_1156864070 15 Left 1156864065 18:41869102-41869124 CCTGGAAGAACTGACAACTGCCT No data
Right 1156864070 18:41869140-41869162 AAATTGACATTTACAGGCTTAGG No data
1156864064_1156864070 16 Left 1156864064 18:41869101-41869123 CCCTGGAAGAACTGACAACTGCC No data
Right 1156864070 18:41869140-41869162 AAATTGACATTTACAGGCTTAGG No data
1156864068_1156864070 -10 Left 1156864068 18:41869127-41869149 CCTTTACAAAATGAAATTGACAT No data
Right 1156864070 18:41869140-41869162 AAATTGACATTTACAGGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156864070 Original CRISPR AAATTGACATTTACAGGCTT AGG Intergenic
No off target data available for this crispr