ID: 1156865268

View in Genome Browser
Species Human (GRCh38)
Location 18:41882066-41882088
Sequence TCTCCCTTTCCAGTAACTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156865265_1156865268 8 Left 1156865265 18:41882035-41882057 CCAAGGCCATTTATATTGTTTTG No data
Right 1156865268 18:41882066-41882088 TCTCCCTTTCCAGTAACTCCTGG No data
1156865267_1156865268 2 Left 1156865267 18:41882041-41882063 CCATTTATATTGTTTTGTTTGGA No data
Right 1156865268 18:41882066-41882088 TCTCCCTTTCCAGTAACTCCTGG No data
1156865264_1156865268 21 Left 1156865264 18:41882022-41882044 CCATCTGAGATCACCAAGGCCAT No data
Right 1156865268 18:41882066-41882088 TCTCCCTTTCCAGTAACTCCTGG No data
1156865262_1156865268 25 Left 1156865262 18:41882018-41882040 CCAACCATCTGAGATCACCAAGG No data
Right 1156865268 18:41882066-41882088 TCTCCCTTTCCAGTAACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156865268 Original CRISPR TCTCCCTTTCCAGTAACTCC TGG Intergenic
No off target data available for this crispr