ID: 1156868102

View in Genome Browser
Species Human (GRCh38)
Location 18:41911616-41911638
Sequence AAAAGCTACCACTCTAAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156868102_1156868104 9 Left 1156868102 18:41911616-41911638 CCAAGTTTAGAGTGGTAGCTTTT No data
Right 1156868104 18:41911648-41911670 CTTCAACAGGAATTCTATTTTGG No data
1156868102_1156868103 -4 Left 1156868102 18:41911616-41911638 CCAAGTTTAGAGTGGTAGCTTTT No data
Right 1156868103 18:41911635-41911657 TTTTATTCATATACTTCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156868102 Original CRISPR AAAAGCTACCACTCTAAACT TGG (reversed) Intergenic
No off target data available for this crispr