ID: 1156875171

View in Genome Browser
Species Human (GRCh38)
Location 18:42001800-42001822
Sequence CAGTCTTAATAGAAATGTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 125}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156875171_1156875173 -4 Left 1156875171 18:42001800-42001822 CCCGCACATTTCTATTAAGACTG 0: 1
1: 0
2: 0
3: 8
4: 125
Right 1156875173 18:42001819-42001841 ACTGCTGATGTACTGTGAAATGG 0: 1
1: 0
2: 0
3: 18
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156875171 Original CRISPR CAGTCTTAATAGAAATGTGC GGG (reversed) Intronic
901618192 1:10558891-10558913 CAGAATTAAAGGAAATGTGCAGG - Intronic
903401257 1:23051476-23051498 CTGTTTTAATAAAAATGGGCAGG - Intronic
904977794 1:34471919-34471941 CAGTTTTATTAGAAATGTTTGGG - Intergenic
907896608 1:58698640-58698662 CAGTCTAGAAAGAAATGAGCTGG - Intronic
911833772 1:102589581-102589603 CAGTATTAACAGAAATTTGGAGG - Intergenic
913565931 1:120072172-120072194 CATTATTAAAATAAATGTGCAGG + Intergenic
913632202 1:120721381-120721403 CATTATTAAAATAAATGTGCAGG - Intergenic
914286516 1:146231536-146231558 CATTATTAAAATAAATGTGCAGG + Intergenic
914547547 1:148682278-148682300 CATTATTAAAATAAATGTGCAGG + Intergenic
914618965 1:149388075-149388097 CATTATTAAAATAAATGTGCAGG - Intergenic
917160597 1:172052941-172052963 CAGGCTTAAAAGTAATGTTCAGG - Intronic
918979050 1:191531130-191531152 CAGTATTAAAAGAAGTGGGCTGG + Intergenic
920254868 1:204647805-204647827 CAGTCCAAATGGAGATGTGCTGG + Intronic
920983034 1:210856214-210856236 CACTCTTCAGAGAAATTTGCTGG + Intronic
1065355284 10:24834683-24834705 CAGTCTTAAGAGTAATGAACTGG - Intergenic
1069023615 10:63517117-63517139 CTCTCTTAATAGAAATGCGAAGG + Intergenic
1070002386 10:72389569-72389591 CAGTGTAAGTAGAATTGTGCAGG + Intronic
1075109481 10:119566569-119566591 CACTCCTAATGGGAATGTGCTGG - Intergenic
1082170006 11:48992384-48992406 AAGTCCTAAGATAAATGTGCAGG - Intergenic
1086695819 11:89844243-89844265 AAGTCCTAAGATAAATGTGCAGG + Intergenic
1086710335 11:90000240-90000262 AAGTCCTAAGATAAATGTGCAGG - Intergenic
1086833260 11:91592579-91592601 CAGTTTTAATAACAATGTACTGG + Intergenic
1092016643 12:5164998-5165020 CAGTTTTATTGGAAATGTGGGGG - Intergenic
1093735123 12:22612618-22612640 AACCCTTAATAAAAATGTGCTGG - Intergenic
1095494533 12:42770722-42770744 CAGTTTTGTTACAAATGTGCAGG + Intergenic
1097579700 12:61439925-61439947 CAGTCCTAATAGAAATATTGTGG + Intergenic
1097665433 12:62472514-62472536 CAGGCCTAATAGAAATTGGCTGG + Intronic
1097883877 12:64709863-64709885 CAGTCTACATAGTAATGTCCTGG + Intergenic
1098980357 12:76949479-76949501 CACTCCTAATAAAAATGTGGGGG - Intergenic
1100682401 12:96941432-96941454 CAATTTAAATAGAAATTTGCAGG - Intronic
1100757053 12:97762996-97763018 CAATCTTAAAAGAACTGTGTTGG + Intergenic
1102224187 12:111216402-111216424 CAGACTAAATAAAAATGTGATGG - Intronic
1102271523 12:111540308-111540330 CAGTCTTACTGAAAATGTCCTGG + Intronic
1107328243 13:39268777-39268799 GTGTATTAATAGAAATGTGGAGG + Intergenic
1108876138 13:55053583-55053605 CTGTCTTAATAGGTATGTGGTGG - Intergenic
1111917766 13:94379431-94379453 CACTCTGATTATAAATGTGCTGG + Intronic
1114053666 14:18945826-18945848 TAGACTGAATAAAAATGTGCAGG + Intergenic
1114108890 14:19456099-19456121 TAGACTGAATAAAAATGTGCAGG - Intergenic
1115030023 14:28784173-28784195 CAGTTTAAATACAAATCTGCCGG + Intronic
1115181647 14:30633605-30633627 CACTTTTCATAGAAATGTGGTGG - Intronic
1115387339 14:32813232-32813254 CAGACGTAAAAGAAATGTGCAGG + Intronic
1117042948 14:51784354-51784376 AAGTGTAAATTGAAATGTGCTGG - Intergenic
1120546196 14:85814249-85814271 CAGGCTTAGTAGAAATCTGAAGG + Intergenic
1125795071 15:42398014-42398036 CTGTCTTAAAAAAAAAGTGCTGG + Intronic
1133104834 16:3500681-3500703 CATTCTTTATAGAAATGAGGGGG + Intergenic
1135006760 16:18831135-18831157 AAGTCTTAATGGTAATGTGAGGG - Intronic
1135801633 16:25502710-25502732 CAGTCATTATATAAATGTGTGGG - Intergenic
1138634636 16:58327978-58328000 CAGTGGTAATAAAAATGTTCTGG - Intronic
1140551493 16:75870805-75870827 CAGTCTAAATAGAGATGTCAAGG + Intergenic
1141826354 16:86483386-86483408 CAGTCTCACTAGAACTGTTCAGG - Intergenic
1151736433 17:75943824-75943846 GAGGTTTAATAGAAATGTGTTGG - Exonic
1153466696 18:5396063-5396085 CACTTTTAATAGAAATGGTCTGG + Intronic
1153909481 18:9694496-9694518 CAGTCTTGACAGAGATGTCCAGG - Intergenic
1154036146 18:10804358-10804380 CAGTCTTAATTGAAGATTGCCGG - Intronic
1155391898 18:25347706-25347728 AACTGTTAATAGAAATGTCCTGG + Intronic
1156875171 18:42001800-42001822 CAGTCTTAATAGAAATGTGCGGG - Intronic
1156914845 18:42453787-42453809 AGGTCTAAATAGAAATGTTCTGG + Intergenic
1159550003 18:69885040-69885062 CAGTAATAATAAAAGTGTGCCGG - Intronic
1162287804 19:9752758-9752780 CAGCCTAAAAAGAAAAGTGCTGG - Intronic
1166819444 19:45568529-45568551 AAGTATTAACAGAATTGTGCAGG + Intronic
929030630 2:37647253-37647275 CAGTCCTAAAGGAAAGGTGCTGG + Intronic
932349503 2:71020936-71020958 CAGTCTCCGTAGAATTGTGCTGG - Intergenic
932998290 2:76884306-76884328 AATTATTAATAGAAATGGGCAGG + Intronic
933380297 2:81534435-81534457 CAGCATTAATAGACATGAGCAGG + Intergenic
935886287 2:107623305-107623327 GAGTCTTGAGAGAAATGTGGTGG + Intergenic
937619115 2:123965328-123965350 CAGAGTTAATGGAAATGTCCAGG - Intergenic
940781346 2:157937185-157937207 CAGTCTTAATAGGAAAGTCAAGG - Intronic
942772380 2:179537441-179537463 CAAATTTAATAGAAATGGGCCGG + Intronic
944503259 2:200383448-200383470 TAGTCTAAAGTGAAATGTGCTGG - Intronic
948018257 2:234708150-234708172 CACTCTTAAGAGAAATGTCTGGG - Intergenic
1175201836 20:57283420-57283442 CAGTAATTATAGAAATTTGCGGG - Intergenic
1178680068 21:34666924-34666946 CAAACTTGATAGAAATGTGCTGG - Intergenic
1179463989 21:41559129-41559151 CAATCTTAATAAAAATTTGGTGG - Intergenic
1180472135 22:15668207-15668229 TAGACTGAATAAAAATGTGCAGG + Intergenic
1181391159 22:22582033-22582055 AAGTCTTAAGATCAATGTGCTGG + Intergenic
952110958 3:30123562-30123584 CAGGGTTAAGAGAAATGAGCAGG - Intergenic
952125772 3:30299016-30299038 CAGTCTTAATTGAAAATTTCTGG - Intergenic
957309755 3:78504868-78504890 CACTCTAAAAAGAAATGTGTAGG - Intergenic
957497869 3:81013708-81013730 CAGGCTTAAAAGAAATGTAGTGG - Intergenic
960895263 3:122497576-122497598 AAGTTTTAATAGCAAAGTGCTGG - Intronic
962311473 3:134329951-134329973 CACTCTTAAAAGAAAAGTGTGGG - Intergenic
964053405 3:152422595-152422617 CAGACTTAATAGACATCTACAGG + Intronic
964996600 3:162890164-162890186 CAATCTTAATAAAAATTTGTGGG + Intergenic
972011798 4:34191655-34191677 CAATTTTAATGGAAATGGGCTGG - Intergenic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
973972165 4:56224300-56224322 TAAACTTAATAGAAATGTGAAGG - Intronic
973976223 4:56265092-56265114 CTGTCATAATGGAAATGTGCTGG + Intronic
974439185 4:61895069-61895091 GAGTCTTAAAATAAGTGTGCAGG - Intronic
975434850 4:74340094-74340116 ATGTTTTAATATAAATGTGCTGG - Intergenic
978333296 4:107638978-107639000 CAGTATGAATAGGAATGTGTGGG - Intronic
980242626 4:130196943-130196965 CAGTCTATATAGAAATGTGTAGG + Intergenic
982187917 4:152820805-152820827 CAGTCGCAGGAGAAATGTGCTGG - Intronic
984951211 4:185009153-185009175 CAGTCTTACTAGAACCGTGAGGG - Intergenic
994265650 5:97712980-97713002 CATTCTTAACAGAAATTTTCTGG + Intergenic
995438023 5:112159737-112159759 TAGTCTGAACGGAAATGTGCTGG + Intronic
996292818 5:121874141-121874163 AACTCCTAATATAAATGTGCTGG - Intergenic
1004933618 6:20486158-20486180 TAGTCTTTTTAGAAATGGGCGGG + Intronic
1005203282 6:23371649-23371671 AAGTATGAATATAAATGTGCGGG - Intergenic
1005283733 6:24302504-24302526 CAGTCTTAAGAGAAAAGGGTGGG - Intronic
1009522093 6:64695449-64695471 CAGTTGTAATAGCAATGTACTGG - Intronic
1009768333 6:68111305-68111327 CAGTCAAAAGAGAAATGAGCCGG - Intergenic
1012384074 6:98656928-98656950 CATTCTTATTAGAGATGTGCAGG - Intergenic
1014823085 6:126015210-126015232 TAGTGATAATAGATATGTGCAGG - Intronic
1016726184 6:147371294-147371316 CAGTCTTAATATAAAGGTTTTGG - Intronic
1018693383 6:166368606-166368628 CATTGTTAATAGAATTCTGCAGG - Intronic
1022236425 7:28466359-28466381 CAGTCTTGAAAGAAAAGTGTTGG + Intronic
1027776118 7:82466493-82466515 CAGTCTTAATTGAAAACTGATGG - Intergenic
1031390571 7:121208886-121208908 CAGTCTGAATAATGATGTGCAGG + Intronic
1033591278 7:142810425-142810447 CAGTTTGTGTAGAAATGTGCAGG - Intergenic
1035944154 8:3941575-3941597 TATTATTAATAGAAATGTGTAGG - Intronic
1038029467 8:23624487-23624509 CAGTTTTACTAGTGATGTGCAGG + Intergenic
1042234392 8:66594499-66594521 CAGTCTTAATCTAAATATGTTGG - Intronic
1042434829 8:68751497-68751519 GAGTCTTAATAGAAAAATGTAGG + Intronic
1043064175 8:75545438-75545460 CATTCTTAATAGGAAGGTGCAGG - Intronic
1043286006 8:78532388-78532410 CAGTTATGATAGAAATGAGCAGG - Intronic
1044587377 8:93880485-93880507 GAGTCATAAAAGAAATATGCAGG - Intronic
1045902596 8:107302081-107302103 AGGTCTCAATAGATATGTGCTGG - Intronic
1046904735 8:119560275-119560297 CAGTCTTATTAGAAACTTGTAGG - Intronic
1048253876 8:132890222-132890244 AAATATTAATAGAAATGTGAAGG - Intronic
1049872175 8:144989081-144989103 CATTCTTAAAAGAACTGGGCTGG - Intergenic
1051786452 9:20749859-20749881 CAATCCTAATAGAAATGAGGGGG - Intronic
1051910226 9:22146570-22146592 CTGTATTAATAGAACTCTGCAGG - Intergenic
1052651333 9:31306552-31306574 GAATCTTAATAGAAGTGTGTGGG - Intergenic
1057587462 9:96342538-96342560 CATTCTTACTAGAGAGGTGCAGG + Intronic
1060609274 9:124947353-124947375 CAGTTTAAATAAAAATTTGCAGG + Intronic
1192557179 X:72099869-72099891 CAGTCTGAACTGAAATGTGCTGG - Intergenic
1195197575 X:102514853-102514875 AAGTCTTAATAGGAATGGGGGGG - Intronic
1196990168 X:121320104-121320126 CAGGCTCCATAGAAATTTGCTGG - Intergenic
1197091561 X:122544782-122544804 CAGCCATTATAGAAATGTGTGGG - Intergenic
1197183192 X:123559220-123559242 CTGTCTTAATAGAAAAGAGCTGG - Intergenic
1199391166 X:147280905-147280927 CAGTCATCATAGCCATGTGCTGG + Intergenic
1199391384 X:147283603-147283625 CAGTCATCATAGCCATGTGCTGG + Intergenic
1199391602 X:147286302-147286324 CAGTCATCATAGCCATGTGCTGG + Intergenic
1201967977 Y:19759037-19759059 AAGCCTTAATAAAAATTTGCTGG + Intergenic