ID: 1156881710

View in Genome Browser
Species Human (GRCh38)
Location 18:42088204-42088226
Sequence GCTTCCTCCTCACCTCCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156881701_1156881710 28 Left 1156881701 18:42088153-42088175 CCCACTGCAACTGGAATAGCTGG No data
Right 1156881710 18:42088204-42088226 GCTTCCTCCTCACCTCCTCTTGG No data
1156881707_1156881710 -9 Left 1156881707 18:42088190-42088212 CCACCCTGGCTGCAGCTTCCTCC No data
Right 1156881710 18:42088204-42088226 GCTTCCTCCTCACCTCCTCTTGG No data
1156881703_1156881710 27 Left 1156881703 18:42088154-42088176 CCACTGCAACTGGAATAGCTGGT No data
Right 1156881710 18:42088204-42088226 GCTTCCTCCTCACCTCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156881710 Original CRISPR GCTTCCTCCTCACCTCCTCT TGG Intergenic
No off target data available for this crispr