ID: 1156883278

View in Genome Browser
Species Human (GRCh38)
Location 18:42105852-42105874
Sequence AACCATGTTCTGTGATTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156883278_1156883279 0 Left 1156883278 18:42105852-42105874 CCTTTAAATCACAGAACATGGTT No data
Right 1156883279 18:42105875-42105897 TCAGTTTAACACTTAGTCCAAGG No data
1156883278_1156883282 30 Left 1156883278 18:42105852-42105874 CCTTTAAATCACAGAACATGGTT No data
Right 1156883282 18:42105905-42105927 CAAAGCTTCCAACTTTACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156883278 Original CRISPR AACCATGTTCTGTGATTTAA AGG (reversed) Intergenic
No off target data available for this crispr