ID: 1156886478 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:42141284-42141306 |
| Sequence | TGCTGTGCATGGAGTGGAGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1156886478_1156886482 | 11 | Left | 1156886478 | 18:42141284-42141306 | CCCTCTCCACTCCATGCACAGCA | No data | ||
| Right | 1156886482 | 18:42141318-42141340 | ACTTAGAGTACCTACTTTCCTGG | No data | ||||
| 1156886478_1156886484 | 25 | Left | 1156886478 | 18:42141284-42141306 | CCCTCTCCACTCCATGCACAGCA | No data | ||
| Right | 1156886484 | 18:42141332-42141354 | CTTTCCTGGATCAGAAGTTTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1156886478 | Original CRISPR | TGCTGTGCATGGAGTGGAGA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||