ID: 1156886478

View in Genome Browser
Species Human (GRCh38)
Location 18:42141284-42141306
Sequence TGCTGTGCATGGAGTGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156886478_1156886482 11 Left 1156886478 18:42141284-42141306 CCCTCTCCACTCCATGCACAGCA No data
Right 1156886482 18:42141318-42141340 ACTTAGAGTACCTACTTTCCTGG No data
1156886478_1156886484 25 Left 1156886478 18:42141284-42141306 CCCTCTCCACTCCATGCACAGCA No data
Right 1156886484 18:42141332-42141354 CTTTCCTGGATCAGAAGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156886478 Original CRISPR TGCTGTGCATGGAGTGGAGA GGG (reversed) Intergenic
No off target data available for this crispr